Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD), Comprehensive Genetic Testing - Targeted NGS Gene Panel (Primary Immunodeficiency / PID and Primary Ciliary Dyskinesia / PCD). Genes: ACD, ACP5, ACTB, ADA, ADAM17, ADAR, AICDA, AIRE, AK2, ALPI, AMN, AP3B1, AP3D1, ARHGEF1, ARMC4, ARPC1B, ATM, ATP6AP1, B2M, BACH2, BCL10, BCL11B, BLM, BLNK - Diagnostic Tests

The Comprehensive Genetic Test for Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD) utilizes next-generation sequencing (NGS) to examine 383 genes associated with immune dysfunction and ciliary structure disorders. It is a targeted gene panel specifically designed to support accurate diagnosis, risk assessment, and prevention.

More Information

The Comprehensive Genetic Test for Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD) is a specialized genetic test designed to evaluate an extensive set of genes associated with disorders of immune function and ciliary structure. The comprehensive genetic test for primary immunodeficiency and primary ciliary dyskinesia includes the assessment of both coding and selected non-coding variants, enabling a broad analysis of genetic alterations that may contribute to disease. It is primarily used in individuals with clinical suspicion of primary immunodeficiency, particularly when overlapping features with primary ciliary dyskinesia are present. Given the genetic heterogeneity and phenotypic overlap of these conditions, the comprehensive genetic test for primary immunodeficiency and primary ciliary dyskinesia supports a more precise and comprehensive diagnostic approach in complex clinical scenarios.

The comprehensive genetic test for primary immunodeficiency and primary ciliary dyskinesia includes genes involved in immune regulation, host defense, and ciliary motility, such as CFTR, DNAH5, LRBA, RAG1, and STAT3. These genes play essential roles in maintaining normal immune responses, mucociliary clearance, and cellular signaling pathways. For example, CFTR is critical for ion transport and mucus consistency, while DNAH5 contributes to the structural integrity of motile cilia. Disruptions in these pathways can impair pathogen clearance and immune competence. The comprehensive genetic test for primary immunodeficiency and primary ciliary dyskinesia is indicated in individuals presenting with recurrent infections, unexplained inflammatory features, or clinical signs suggestive of ciliary dysfunction.

The clinical spectrum of primary immunodeficiencies and primary ciliary dyskinesia is broad and variable. Primary immunodeficiencies (PIDs) may manifest with recurrent, severe, or unusual infections, autoimmune phenomena, and inflammatory complications, often involving multiple organ systems. Symptoms may overlap across different categories, complicating clinical classification. Primary ciliary dyskinesia (PCD) is typically characterized by chronic respiratory symptoms, including persistent wet cough, rhinitis, and recurrent lower airway infections from early life. Additional features may include situs abnormalities, neonatal respiratory distress, and recurrent otitis media. In some cases, infertility may be observed due to impaired ciliary or flagellar function. The onset and severity of symptoms vary depending on the underlying genetic defect.

The purpose of the comprehensive genetic test for primary immunodeficiency and primary ciliary dyskinesia is to identify pathogenic variants that contribute to disorders of immune deficiency and ciliary dysfunction, facilitating accurate diagnosis and improved disease classification. By clarifying the underlying genetic cause, the test supports differentiation between overlapping conditions and helps to better understand disease mechanisms. It also contributes to risk assessment, informs clinical management strategies, and enables more precise prognostic evaluation. The inclusion of genes associated with cystic fibrosis further enhances its diagnostic scope in patients with overlapping respiratory phenotypes.

A higher genetic risk is confirmed when pathogenic mutations are found in genes associated with primary immunodeficiency and ciliary dysfunction. A lower risk may be inferred when no mutations are detected, though comprehensive clinical follow-up is still essential. The integration of genetic data with clinical findings and family history is critical for precise diagnosis, prognosis, and long-term patient care.

The test is performed in a clinical laboratory accredited to ISO 15189 and certified by CLIA and CAP, ensuring the validity, accuracy and international recognition of the results.

Genes and Associated Phenotypes (Comprehensive Genetic Testing for Primary Immunodeficiency and Primary Ciliary Dyskinesia)

Gene	Associated phenotypes	Inheritance	ClinVar	HGMD

ACD	Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7	AD/AR	2	8
ACP5	Spondyloenchondrodysplasia with immune dysregulation	AR	12	26
ACTB*	Baraitser-Winter syndrome	AD	55	60
ADA	Severe combined immunodeficiency due to adenosine deaminase deficiency	AR	49	93
ADAM17	Inflammatory skin and bowel disease, neonatal 1	AR	1	7
ADAR	Dyschromatosis symmetrica hereditaria, Aicardi-Goutières syndrome	AD/AR	25	226
AICDA	Immunodeficiency with hyper-IgM	AD/AR	14	50
AIRE	Autoimmune polyendocrinopathy syndrome	AD/AR	73	134
AK2	Reticular dysgenesis	AR	14	17
ALPI	Inflammatory bowel disease	AR		5
AMN	Megaloblastic anemia-1, Norwegian	AR	29	34
AP3B1	Hermansky-Pudlak syndrome	AR	14	34
AP3D1	Hermansky-Pudlak syndrome 10	AR	1	4
ARHGEF1	Idiopathic bronchiectasis, Immunodeficiencies with antibody defects	AR		1
ARMC4#*	Ciliary dyskinesia	AR	18	17
ARPC1B	Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease	AR	2	4
ATM	Breast cancer, Ataxia-Telangiectasia	AD/AR	1047	1109
ATP6AP1	Immunodeficiency 47	XL	5	5
B2M	Amyloidosis, systemic visceral	AR	8	4
BACH2	BACH2-related immunodeficiency and autoimmunity (BRIDA)	AD		2
BCL10	Immunodeficiency 37	AR	16	1
BCL11B	Immunodeficiency 49	AD	8	12
BLM	Bloom syndrome	AR	152	119
BLNK	Agammaglobulinemia 4	AR	2	3
BTK	Hypogammaglobulinemia, Agammaglobulinemia and isolated hormone deficiency, Agammaglobulinemia	XL	114	908
C11ORF70	Primary ciliary dyskinesia	AR		5
C17ORF62	Chronic granulomatous disease	AR		1
C1QA	C1q deficiency	AR	2	7
C1QB	C1q deficiency	AR	4	8
C1QC	C1q deficiency	AR	4	10
C1S	Complement component C1s deficiency	AD/AR	4	10
C2*	Complement component 2 deficiency	AR	4	9
C21ORF59	Ciliary dyskinesia	AR	5	4
C3	Hemolytic uremic syndrome, atypical, Complement component 3 deficiency, Macular degeneration, age-related	AD/AR	6	87
C5#	Eculizumab, poor response to, Complement component 5 deficiency	AD/AR	6	18
C6	Complement component 6 deficiency	AR	8	12
C7	Complement component 7 deficiency	AR	14	31
C8A	Complement component 8 deficiency	AR	2	8
C8B	Complement component 8 deficiency	AR	7	8
C9	Complement component 9 deficiency	AR	7	9
CARD11	B-cell expansion with NFKB and T-cell anergy, Immunodeficiency	AD/AR	12	9
CARD14	Psoriasis	AD	9	29
CARD9	Candidiasis, familial, 2	AR	8	25
CASP10	Autoimmune lymphoproliferative syndrome	AD	5	7
CASP8	Caspase 8 defiency	AR	2	7
CCBE1	Hennekam lymphangiectasia-lymphedema syndrome	AR	6	13
CCDC103	Ciliary dyskinesia	AR	4	5
CCDC114	Ciliary dyskinesia, primary, 20	AR	9	8
CCDC151	Ciliary dyskinesia, primary, 30	AR	7	2
CCDC39	Ciliary dyskinesia	AR	39	47
CCDC40	Ciliary dyskinesia	AR	33	43
CCDC65	Ciliary dyskinesia	AR	2	2
CCNO	Ciliary dyskinesia	AR	11	10
CD19	Immunodeficiency, common variable	AR	8	9
CD247	Immunodeficiency	AR	8	4
CD27	Lymphoproliferative syndrome	AR	4	8
CD3D	Immunodeficiency	AR	3	5
CD3E	Immunodeficiency	AR	4	7
CD3G	Immunodeficiency	AR	5	3
CD4	OKT4 epitope deficiency	AR	1
CD40	Immunodeficiency with Hyper-IgM	AR	5	10
CD40LG	Immunodeficiency, with hyper-IgM	XL	35	231
CD46*	Hemolytic uremic syndrome, atypical	AD/AR	5	81
CD55#	Blood group, Cromer system	BG	7	7
CD59	CD59 deficiency	AR	4	8
CD70	Primary immunodeficiency	AR		4
CD79A	Agammaglobulinemia 3	AR	3	7
CD79B	Agammaglobulinemia 6	AR	2	3
CD81	Immunodeficiency, common variable, 6	AR	1	1
CD8A	CD8 deficiency	AR	1	1
CDC42*	Takenouchi-Kosaki syndrome, Noonan-syndrome like phenotype	AD	11	9
CDCA7	Immunodeficiency-centromeric instability-facial anomalies syndrome 3	AR	4	6
CDK9		AR		1
CEBPE	Specific granule deficiency 1	AR	3	4
CECR1	Polyarteritis nodosa, ADA2 deficiency	AR	15	50
CENPF	Ciliary dyskinesia -Lethal Ciliopathy	AR	13	8
CFAP57	van der Woude syndrome 2	AD		2
CFB	Complement factor B deficiency, Hemolytic uremic syndrome, atypical	AD/AR	2	26
CFD	Complement factor D deficiency	AR	2	3
CFH*	Hemolytic uremic syndrome, atypical, Complement factor H deficiency, Basal laminar drusen	AD/AR	18	305
CFI	Hemolytic uremic syndrome, atypical, Complement factor I deficiency	AD/AR	10	143
CFP	Properdin deficiency	XL	5	17
CFTR	Cystic fibrosis, Congenital bilateral absence of the vas deferens	AD/AR	518	1803
CHD7	Isolated gonadotropin-releasing hormone deficiency, CHARGE syndrome	AD	276	860
CIITA	Bare lymphocyte syndrome	AR	9	15
CLCN7	Osteopetrosis	AD/AR	15	98
CLPB	3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN)	AD/AR	26	25
COG6	Congenital disorder of glycosylation, Shaheen syndrome	AR	10	9
COLEC11	3MC syndrome	AR	6	13
COPA	Autoimmune interstitial lung, joint, and kidney disease	AD	6	6
CORO1A#*	Immunodeficiency	AR	41	6
CR2	Common variable immunodeficiency	AR	2	16
CSF2RA#*	Surfactant metabolism dysfunction, pulmonary	XL	2	17
CSF2RB	Surfactant metabolism dysfunction, pulmonary, 5	AR	2	6
CSF3R	Neutrophilia, hereditary	AD/AR	13	13
CTC1	Cerebroretinal microangiopathy with calcifications and cysts	AR	21	33
CTLA4	Autoimmune lymphoproliferative syndrome, type V	AD	11	34
CTPS1	Immunodeficiency 24	AR	1	1
CTSC	Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome	AR	19	92
CXCR4	Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome	AD	5	15
CYBA	Chronic granulomatous disease	AR	13	71
CYBB	Chronic granulomatous disease, Immunodeficiency	XL	69	780
CYP27A1	Cerebrotendinous xanthomatosis	AR	69	110
DBR1	Immunodeficiency	AR		1
DCLRE1C*	Omenn syndrome, Severe combined immunodeficiency with sensitivity to ionizing radiation	AR	18	89
DDX58	Singleton-Merten syndrome	AD	4	3
DGAT1	Diarrhea	AR	7	11
DGKE	Nephrotic syndrome	AR	17	38
DIAPH1	Seizures, cortical blindness, and microcephaly syndrome (SCBMS), Deafness, autosomal dominant 1	AD/AR	10	15
DKC1	Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita	XL	48	74
DNAAF1	Ciliary dyskinesia	AR	19	38
DNAAF2	Ciliary dyskinesia	AR	13	6
DNAAF3	Primary ciliary dyskinesia	AR	11	5
DNAAF5	Ciliary dyskinesia	AR	9	5
DNAH1	Spermatogenic failure 18, Ciliary dyskinesia, primary, 37	AR	15	32
DNAH11*	Ciliary dyskinesia	AR	66	130
DNAH5	Ciliary dyskinesia	AR	140	197
DNAH8	Primary ciliary dyskinesia	AR	18	4
DNAH9	Primary ciliary dyskinesia	AR		6
DNAI1	Ciliary dyskinesia	AR	17	35
DNAI2	Ciliary dyskinesia	AR	19	6
DNAJB13	Ciliary dyskinesia, primary, 34	AR	2	2
DNAJC21	Bone marrow failure syndrome 3	AR	5	11
DNAL1	Ciliary dyskinesia	AR	3	1
DNASE1L3	Systemic lupus erythematosus 16	AR	1	3
DNASE2	Autoinflammatory-pancytopenia syndrome	AR		2
DNMT3B	Immunodeficiency-centromeric instability-facial anomalies syndrome	AR	14	47
DOCK2	Immunodeficiency	AR	7	6
DOCK8	Hyper-IgE recurrent infection syndrome, Mental retardation, autosomal dominant 2	AR	54	168
DRC1	Ciliary dyskinesia, primary, 21	AR	5	3
DSG1	Severe dermatitis, multiple allergies, and metabolic wasting syndrome (SAM syndrome), Keratosis palmoplantaris striata I	AD/AR	13	31
DYX1C1	Ciliary dyskinesia	AR	15	12
EFL1*	Shwachman-Diamond syndrome	AR	3	2
ELANE	Neutropenia	AD	43	217
EPG5	Vici syndrome	AR	36	66
ERCC6L2	Bone marrow failure syndrome 2	AR	4	9
EXTL3	Immunoskeletal dysplasia with neurodevelopmental abnormalities (ISDNA)	AR	4	8
FADD	Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations	AR	2	1
FANCA	Fanconi anemia	AR	191	677
FAS	Autoimmune lymphoproliferative syndrome	AD/AR	31	133
FASLG	Autoimmune lymphoproliferative syndrome, type IB	AD/AR	2	10
FAT4	Van Maldergem syndrome 2	AR	13	33
FCGR3A*	Immunodeficiency 20	AR		1
FCHO1	Combined immunodeficiency	AR
FERMT3	Leukocyte adhesion deficiency	AR	8	14
FOXN1	T-cell immunodeficiency, congenital alopecia, and nail dystrophy	AD/AR	6	6
FOXP3	Immunodysregulation, polyendocrinopathy, and enteropathy	XL	28	93
G6PC	Glycogen storage disease	AR	46	117
G6PC3	Neutropenia, severe congenital, Dursun syndrome	AR	11	37
G6PD	Glucose-6-phosphate dehydrogenase deficiency	XL	45	226
GAS2L2	Primary ciliary dyskinesia	AR		3
GAS8	Ciliary dyskinesia, primary, 33	AR	4	6
GATA2	Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency	AD	30	142
GFI1	Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults	AD	2	6
GINS1	Immunodeficiency	AR	4	4
GUCY2C	Diarrhea, Meconium ileus	AD/AR	7	10
HAVCR2		AR
HAX1	Neutropenia, severe congenital	AR	11	21
HELLS	Immunodeficiency-centromeric instability-facial anomalies syndrome 4	AR	6	6
HMOX1	Heme oxygenase 1 deficiency	AR	2	5
HYDIN#*	Primary ciliary dyskinesia	AR	5	25
HYOU1	Combined immunodeficiency	AR		2
ICOS	Immunodeficiency, common variable, 1	AR	3	4
IFIH1	Singleton-Merten syndrome, Aicardi-Goutieres syndrome 7	AD/AR	14	19
IFNAR2	Immunodeficiency 45	AR	1	2
IFNGR1	Immunodeficiency	AD/AR	16	42
IFNGR2	Immunodeficiency	AR	4	18
IGLL1*	Agammaglobulinemia	AR	2	3
IKBKB	Immunodeficiency 15	AR	2	7
IKZF1	Immunodeficiency, common variable, 13	AD	10	35
IL10	Inflammatory bowel disease	AD/AR	1	5
IL10RA	Inflammatory bowel disease	AR	4	43
IL10RB	Inflammatory bowel disease	AR	2	19
IL12B	Immunodeficiency 28, Immunodeficiency 29	AR	4	13
IL12RB1#	Immunodeficiency	AR	13	82
IL17RA	Immunodeficiency 51	AR	8	17
IL17RC	Candiasis, familial, 9	AR	3	4
IL1RN	Osteomyelitis, sterile multifocal, with periostitis and pustulosis	AR	6	12
IL21	Immunodeficiency, common variable, 11	AR	1	1
IL21R	Immunodeficiency, primary, autosomal recessive, IL21R-related	AD/AR	3	9
IL23R	Primary immunodeficiency	AR	1
IL2RA	Interleukin 2 receptor, alpha, deficiency	AR	6	6
IL2RB	Autoinflammatory-pancytopenia syndrome	AR
IL2RG	Combined immunodeficiency	XL	54	243
IL36RN	Pustular psoriasis, generalized	AR	6	26
IL6R#	Autoinflammatory-pancytopenia syndrome	AR		1
IL6ST*	Autoinflammatory-pancytopenia syndrome	AD/AR
IL7	Interleukin 7 deficiency, Generalized verrucosis, HPV susceptibility	AD/AR
IL7R	Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive	AR	23	48
INVS	Nephronophthisis	AR	16	34
IRAK4	IRAK4 deficiency, Invasive pneumococcal disease, recurrent, isolated, 1	AR	12	29
IRF2BP2	Immunodeficiency, common variable, 14	AD	1	2
IRF4	Skin/hair/eye pigmentation, variation in, 8	AD		1
IRF7	Immunodeficiency 39	AR	2	2
IRF8	Immunodeficiency 32A (CD11C-positive/CD1C-positive dendritic cell deficiency), Immunodeficiency 32B (monocyte and dendritic cell deficiency)	AD/AR	4	8
ISG15	Immunodeficiency, with basal ganglia calcification	AR	3	3
ITGB2	Leukocyte adhesion deficiency	AR	33	118
ITK	Lymphoproliferative syndrome	AR	4	11
JAGN1	Neutropenia, severe congenital	AR	8	8
JAK1	Primary immunodeficiency	AD/AR	4	6
JAK3	Severe combined immunodeficiency, T cell-negative, B cell-positive, natural killer cell-negative	AR	30	66
KRAS*	Noonan syndrome, Cardiofaciocutaneous syndrome	AD	63	35
LAMTOR2	Immunodeficiency due to defect in MAPBP-interacting protein	AR	1	1
LAT	Immunodeficiency 52	AR	2	18
LCK	Immunodeficiency	AR	2	3
LIG1	Autoinflammatory-pancytopenia syndrome	AR		3
LIG4	Severe combined immunodeficiency with sensitivity to ionizing radiation, LIG4 syndrome	AR	18	36
LPIN2	Majeed syndrome	AR	12	14
LRBA	Common variable immunodeficiency	AR	23	64
LRRC56		AR	43	1
LRRC6	Ciliary dyskinesia	AR	10	19
LYST*	Chediak-Higashi syndrome	AR	50	97
MAGT1	Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95	XL	8	14
MALT1	Immunodeficiency	AR	3	5
MAP3K14	Primary immunodeficiency with multifaceted aberrant lymphoid immunity	AR	1	2
MASP1	3MC syndrome	AR	11	22
MCIDAS	Primary ciliary dyskinesia	AR	4	3
MCM4	Natural killer cell and glucocorticoid deficiency with DNA repair defect		1	5
MEFV	Familial Mediterranean fever	AD/AR	29	182
MKL1	Primary immunodeficiency	AR		4
MOGS	Congenital disorder of glycosylation	AR	7	8
MRE11A	Ataxia-telangiectasia-like disorder-1	AR	57	56
MSN*	Immunodeficiency 50	XL	2	2
MTHFD1	Severe combined immunodeficiency	AR	9	11
MVK	Mevalonic aciduria, Hyper-IgD syndrome, Porokeratosis 3, multiple types	AD/AR	35	181
MYD88	MYD88 deficiency	AR	5	5
MYO5A	Griscelli syndrome	AR	7	9
NBN	Breast cancer, Nijmegen breakage syndrome	AR	188	97
NCF1#*	Chronic granulomatous disease	AR	18	44
NCF2	Chronic granulomatous disease	AR	19	72
NCF4	Granulomatous disease	AR	4	5
NCSTN	Acne inversa, familial 1	AD	7	30
NFE2L2			11	6
NFKB1	Common variable immunodeficiency	AD	8	17
NFKB2	Common variable immunodeficiency	AD	6	11
NFKBIA	Ectodermal dysplasia, anhidrotic, with T-cell immunodeficiency	AD	5	11
NHEJ1	Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation	AR	15	16
NHP2	Dyskeratosis congenita	AR	5	3
NLRC4	Autoinflammation with infantile enterocolitis (AIFEC), Familial cold autoinflammatory syndrome 4	AD	6	8
NLRP1	Palmoplantar carcinoma, multiple self-healing, Autoinflammation with arthritis and dyskeratosis	AD/AR	5	15
NLRP12	Familial cold autoinflammatory syndrome	AD	12	12
NLRP3	Neonatal onset multisystem inflammatory disease (NOMID), Muckle-Wells syndrome, Chronic infantile neurologic cutaneous articular (CINCA) syndrome, Familial cold-induced autoinflammatory syndrome 1, Deafness	AD	20	136
NME8	Ciliary dyskinesia	AR	1	6
NOD2	Blau syndrome, Sarcoidosis, early-onset	AD	12	70
NOP10	Dyskeratosis congenita	AR	1	1
NRAS	Noonan syndrome	AD	31	14
NSMCE3	Lung disease, immunodeficiency, and chromosome breakage syndrome (LICS)	AR	2	2
OBFC1			2	2
OFD1	Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, Orofaciodigital syndrome, Joubert syndrome	XL	153	160
ORAI1	Immunodeficiency, Myopathy, tubular aggregate, 2	AD/AR	9	13
OTULIN	Autoinflammation, panniculitis, and dermatosis syndrome (AIPDS)	AR	8	3
PARN*	Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita	AD/AR	15	29
PEPD	Prolidase deficiency	AR	12	31
PGM3#	Immunodeficiency 23	AR	14	15
PIGA*	Multiple congenital anomalies-hypotonia-seizures syndrome	XL	24	27
PIH1D3	Ciliary dyskinesia, primary, 36	XL	2	12
PIK3CD*	Immunodeficiency	AD	6	12
PIK3R1	Agammaglobulinemia, SHORT syndrome	AD/AR	33	24
PLCG2	Familial cold autoinflammatory syndrome 3 (PLAID), Autoinflammation, antibody deficiency, and immune dysregulation syndrome (APLAID)	AD	7	13
PMS2#*	Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis	AD/AR	319	342
PNP	Purine nucleoside phosphorylase deficiency	AR	11	33
POLA1	Pigmentary disorder, reticulate, with systemic manifestations, X-linked, Neurodevelopmental disorder		2	1
POLD1	Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency	AD/AR	3	31
POLE	Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome)	AD/AR	8	70
POLE2	Combined immunodeficiency	AR		3
POMP	Keratosis linearis with ichthyosis congenita and sclerosing keratoderma	AR	5	4
PRF1	Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis	AR	24	183
PRG4	Camptodactyly-arthropathy-coxa vara-pericarditis syndrome	AR	6	35
PRKCD	Autoimmune lymphoproliferative syndrome type III	AR	4	6
PRKDC	Immunodeficiency	AR	6	9
PSENEN	Acne inversa, familial, 2	AD	7	17
PSMB4			4	4
PSMB8	Nakajo-Nishimura syndrome, Chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature syndrome, Autoinflammation, lipodystrophy, and dermatosis syndrome, Joint contractures, muscular atrophy, microcytic anemia, and panniculitis-induced lipodystrophy syndrome	AR	5	9
PSTPIP1	Pyogenic sterile arthritis, pyoderma gangrenosum, and acne	AD	5	29
PTPRC	Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive	AR	4	5
RAB27A	Griscelli syndrome, Elejalde syndrome	AR	18	54
RAC2	Neutrophil immunodeficiency syndrome	AD/AR	2	3
RAG1	Omenn syndrome, Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity, T cell-negative, B cell-negative, natural killer cell-positive severe combined immunodeficiency, Combined cellular and humoral immune defects with granulomas	AR	47	184
RAG2	Omenn syndrome, Combined cellular and humoral immune defects with granulomas	AR	28	79
RANBP2*	Encephalopathy, acute, infection-induced, 3, susceptibility to	AD	41	6
RASGRP1	Primary immunodeficiency	AR	1	3
RBCK1	Polyglucosan body myopathy	AR	11	14
RECQL4	Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome	AR	82	114
RELA*	Autoimmune lymphoproliferative syndrome, Autoinflammatory syndrome, familial, Behcet-like	AD	1	3
RELB	Immunodeficiency 53		1	1
RFX5	Bare lymphocyte syndrome	AR	4	10
RFXANK	MHC class II deficiency	AR	8	16
RFXAP	Bare lymphocyte syndrome	AR	6	9
RHOH	T-cell immunodeficiency with epidermodysplasia verruciformis	AD/AR		1
RIPK1	Autoinflammatory-pancytopenia syndrome	AD/AR	3	1
RLTPR	Combined immunodeficiency	AR	11	8
RMRP	Cartilage-hair hypoplasia, Metaphyseal dysplasia without hypotrichosis, Anauxetic dysplasia	AR	87	123
RNASEH2A	Aicardi-Goutières syndrome	AR	13	21
RNASEH2B	Aicardi-Goutières syndrome	AR	16	41
RNASEH2C	Aicardi-Goutières syndrome	AR	6	14
RNF168	RIDDLE syndrome	AR	4	5
RNF31	HOIP and LUBAC deficiency	AR		1
RNU4ATAC	Roifman syndrome, Microcephalic osteodysplastic primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3	AR	15	24
RORC	Immunodeficiency 42	AR	3	3
RPGR	Retinitis pigmentosa, Cone-rod dystrophy, X-linked, 1, Macular degeneration, X-linked atrophic, Retinitis pigmentosa 3	XL	79	218
RPSA	Asplenia, isolated congenital	AD	7	8
RSPH1	Ciliary dyskinesia	AR	14	10
RSPH3	Ciliary dyskinesia, primary, 32	AR	7	5
RSPH4A	Ciliary dyskinesia	AR	18	24
RSPH9	Ciliary dyskinesia	AR	8	12
RTEL1	Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita	AD/AR	58	51
SAMD9	Mirage syndrome, Tumoral calcinosis, normophosphatemic	AD/AR	10	27
SAMD9L	Ataxia-pancytopenia syndrome	AD	4	16
SAMHD1	Aicardi-Goutières syndrome, Chilblain lupus 2	AD/AR	25	56
SBDS*	Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia	AR	19	90
SEC61A1	Hyperuricemic nephropathy, familial juvenile 4	AD	4	4
SERPING1	Angioedema, Complement component 4, partial deficiency of	AD/AR	34	563
SH2D1A	Lymphoproliferative syndrome	XL	21	129
SLC29A3	Histiocytosis-lymphadenopathy plus syndrome, Dysosteosclerosis	AR	17	25
SLC35C1	Congenital disorder of glycosylation, Leukocyte adhesion deficiency	AR	6	7
SLC37A4	Glycogen storage disease	AD/AR	49	113
SLC39A7	Agammaglobulinemia	AR
SLC46A1	Folate malabsorption	AR	17	23
SLC7A7	Lysinuric protein intolerance	AR	55	67
SMARCAL1	Schimke immunoosseous dysplasia	AR	20	88
SMARCD2	Specific granule defiency 2	AR	3	1
SP110	Hepatic venoocclusive disease with immunodeficiency	AR	8	8
SPAG1	Primary ciliary dyskinesia	AR	18	11
SPINK5	Netherton syndrome	AR	29	85
SPPL2A	Autoinflammatory-pancytopenia syndrome	AR	1
SRP54	Shwachman-Diamond syndrome	AD	3
SRP72*	Bone marrow failure syndrome 1	AD	2	5
STAT1	Immunodeficiency	AD/AR	39	122
STAT2	Immunodeficiency	AR	3	6
STAT3	Hyper-IgE recurrent infection syndrome, Autoimmune disease, multisystem, infantile onset	AD	47	152
STAT5B*	Growth hormone insensitivity with immunodeficiency	AD/AR	9	13
STIM1	Stormorken syndrome, Immunodeficiency, Myopathy, tubular aggregate 1	AD/AR	13	24
STK36	Primary ciliary dyskinesia	AR		5
STK4	T-cell immunodeficiency syndrome, recurrent infections, autoimmunity,	AR	3	7
STX11	Hemophagocytic lymphohistiocytosis, familial	AR	8	22
STXBP2	Hemophagocytic lymphohistiocytosis, familial	AR	12	77
TAP1	Bare lymphocyte syndrome	AR	1	7
TAP2	Bare lymphocyte syndrome	AR	4	8
TAPBP	Bare lymphocyte syndrome	AR	1	2
TAZ	3-Methylglutaconic aciduria, (Barth syndrome)	XL	45	158
TBX1	Conotruncal anomaly face syndrome	AD	17	72
TCF3	Agammaglobulinemia 8, autosomal dominant	AD	1	5
TCN2	Transcobalamin II deficiency	AR	9	35
TERC	Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita	AD	42	73
TERT	Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita	AD/AR	48	156
TFRC	Immunodeficiency 46	AR	8	2
TGFB1	Diaphyseal dysplasia Camurati-Engelmann, Inflammatory bowel disease	AD/AR	15	23
THBD	Thrombophilia due to thrombomodulin defect, Hemolytic uremic syndrome, atypical	AD	5	28
TINF2	Revesz syndrome, Dyskeratosis congenita	AD	25	42
TLR3	Herpes simplex encephalitis, susceptibility to, 2	AD/AR		14
TMC6	Epidermodysplasia verruciformis	AR	8	7
TMC8	Epidermodysplasia verruciformis	AR	3	9
TMEM173	STING-associated vasculopathy, infantile-onsent (SAVI)	AD/AR	4	10
TNFAIP3	Autoinflammatory syndrome, familial, Behcet-like	AD	8	23
TNFRSF13B	Common variable immunodeficiency, Immunoglobulin A deficiency	AD/AR	7	48
TNFRSF1A#	Periodic fever (TNF receptor-associated periodic syndrome)	AD	19	106
TNFRSF4	Immunodeficiency	AR	1	1
TNFRSF9	Immunodeficiency	AR
TRAF3IP2	Candidiasis, familial 8	AR	1	3
TREX1	Vasculopathy, retinal, with cerebral leukodystrophy, Chilblain lupus, Aicardi-Goutières syndrome	AD/AR	30	71
TRNT1	Retinitis pigmentosa and erythrocytic microcytosis, Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay	AR	13	26
TTC25	Ciliary dyskinesia, primary, 35	AR	2	2
TTC37	Trichohepatoenteric syndrome, Autoinflammatory-pancytopenia syndrome	AR	12	64
TTC7A	Gastrointestinal defects and immunodeficiency syndrome	AR	21	46
TYK2	Immunodeficiency	AR	9	9
UBA1	Spinal muscular atrophy, infantile	XL	3	5
UNC119	Immunodeficiency, Cone-rod dystrophy 2	AD	1	5
UNC13D	Hemophagocytic lymphohistiocytosis, familial	AR	22	192
UNC93B1*	Herpes simplex encephalitis, susceptibility to, 1	AR		2
UNG	Immunodeficiency with hyper-IgM, type 5	AR	6	7
USB1	Poikiloderma with neutropenia	AR	24	22
USP18#*	Pseudo-TORCH syndrome 2	AR	40	1
VPS13B	Cohen syndrome	AR	351	203
VPS45#	Neutropenia, severe congenital, 5, autosomal recessive	AR	3	4
WAS	Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome	XL	57	439
WDR1		AR		8
WIPF1	Wiskott-Aldrich syndrome 2	AR	2	3
WRAP53	Dyskeratosis congenita	AR	7	6
XIAP*	Lymphoproliferative syndrome	XL	14	96
ZAP70	Selective T-cell defect	AR	15	29
ZBTB24	Immunodeficiency-Centromeric Instability-Facial Anomalies 2	AR	7	17
ZMYND10	Ciliary dyskinesia	AR	8	16
ZNF341*		AR		5

Notes

# A gene marked with this symbol has suboptimal coverage. Fewer than 90% of the gene’s target nucleotides are covered at >20x with mapping quality (MQ>20) reads. Certain exons listed in the Test Limitations section may be excluded if they cannot be reliably sequenced.

* Some or all regions of the gene are duplicated in the genome, which may reduce sensitivity for variant detection. Genes marked with * or # may not be available as single-gene tests.

Abbreviations & References

Gene → HGNC-approved gene symbol.
Inheritance → autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD), X-linked recessive (XLR).
ClinVar → count of pathogenic/likely pathogenic variants (ClinVar).
HGMD → count of variants with possible disease association (HGMD).
Associated phenotypes → compiled from CGD or Mitomap.

Non-coding variants covered by the Comprehensive Genetic Test for Primary Immunodeficiency and Primary Ciliary Dyskinesia

Gene	Genomic location HG19	HGVS	RefSeq	RS-number
ADA	Chr20:43248503	c.1079-15T>A	NM_000022.2	rs387906268
ADA	Chr20:43249076	c.976-34G>A	NM_000022.2
AMN	Chr14:103395424	c.514-34G>A	NM_030943.3	rs144077391
AMN	Chr14:103396444	c.1007-31_1006+34delCCTCGCCCCGCCGCG	NM_030943.3	rs386834161
AMN	Chr14:103396458	c.1007-29_1006+36delTCGCCCCGCCGCGGG	NM_030943.3	rs386834162
ATM	Chr11:108093770	c.-174A>G	NM_000051.3
ATM	Chr11:108094508	c.-31+595G>A	NM_000051.3
ATM	Chr11:108098321	c.-30-1G>T	NM_000051.3	rs869312754
ATM	Chr11:108138753	c.2639-384A>G	NM_000051.3
ATM	Chr11:108141209	c.2839-579_2839-576delAAGT	NM_000051.3
ATM	Chr11:108151710	c.3403-12T>A	NM_000051.3	rs201370733
ATM	Chr11:108158168	c.3994-159A>G	NM_000051.3	rs864622543
ATM	Chr11:108164028	c.4612-12A>G	NM_000051.3
ATM	Chr11:108179837	c.5763-1050A>G	NM_000051.3	rs774925473
ATM	Chr11:108214779	c.8418+681A>G	NM_000051.3	rs748635985
BTK	ChrX:100609705	c.1567-23A>C/G	NM_000061.2
BTK	ChrX:100609705	c.1567-23A>G	NM_000061.2
BTK	ChrX:100609705	c.1567-23A>C	NM_000061.2
BTK	ChrX:100612468	c.1177+28_1177+29insAGAAAAAAGGT	NM_000061.2
BTK	ChrX:100613695	c.895-11C>A	NM_000061.2
BTK	ChrX:100625094	c.310-28_310-27delGCinsTG	NM_000061.2
BTK	ChrX:100629415	c.240+109C>A	NM_000061.2
BTK	ChrX:100629416	c.240+108T>G	NM_000061.2
BTK	ChrX:100629827	c.142-205A>G	NM_000061.2
BTK	ChrX:100630121	c.141+11C>T	NM_000061.2	rs138411530
BTK	ChrX:100641044	c.-31+6T>G	NM_000061.2
BTK	ChrX:100641045	c.-31+5G>A/C/T	NM_000061.2
BTK	ChrX:100641045	c.-31+5G>A	NM_000061.2
BTK	ChrX:100641045	c.-31+5G>T	NM_000061.2	rs1131691354
BTK	ChrX:100641045	c.-31+5G>C	NM_000061.2
BTK	ChrX:100641049	c.-31+1G>A/C	NM_000061.2
BTK	ChrX:100641049	c.-31+1G>A	NM_000061.2
BTK	ChrX:100641049	c.-31+1G>C	NM_000061.2
BTK	ChrX:100641050	c.-31G>A	NM_000061.2
BTK	ChrX:100641212	c.-193A>G	NM_000061.2
C1QB	Chr1:22985931	c.-17-2A>C	NM_000491.3
C7	Chr5:40931143	c.63-23T>A	NM_000587.2	rs772462732
CCDC39	Chr3:180365042	c.1363-11A>G	NM_181426.1
CCDC39	Chr3:180367928	c.1167+1261A>G	NM_181426.1	rs577069249
CCDC39	Chr3:180367941	c.1167+1248A>G	NM_181426.1
CD40LG	ChrX:135736498	c.289-32_289-25delAAAATGAC	NM_000074.2
CD40LG	ChrX:135736517	c.289-15T>A	NM_000074.2
CD40LG	ChrX:135737600	c.347-915A>T	NM_000074.2
CD46	Chr1:207930564	c.286+27delT	NM_002389.4	rs771669828
CECR1	Chr22:17664763	c.1082-1113delA	NM_017424.2
CFTR	Chr7:117119654	c.-495C>T	NM_000492.3	rs397507565
CFTR	Chr7:117119797		NM_000492.3
CFTR	Chr7:117119900	c.-249G>C	NM_000492.3
CFTR	Chr7:117119984	c.-165G>A	NM_000492.3	rs145483167
CFTR	Chr7:117120064	c.-85C>G	NM_000492.3
CFTR	Chr7:117120115	c.-34C>T	NM_000492.3	rs756314710
CFTR	Chr7:117120325	c.53+124T>C	NM_000492.3
CFTR	Chr7:117179040	c.870-1113_870-1110delGAAT	NM_000492.3	rs397508809
CFTR	Chr7:117182041	c.1117-26_1117-25delAT	NM_000492.3	rs397508159
CFTR	Chr7:117199500	c.1393-18G>A	NM_000492.3	rs397508199
CFTR	Chr7:117227774	c.1585-19T>C	NM_000492.3	rs778457306
CFTR	Chr7:117227921	c.1679+34G>T	NM_000492.3	rs767901668
CFTR	Chr7:117229521	c.1680-886A>G	NM_000492.3	rs397508266
CFTR	Chr7:117229524	c.1680-883A>G	NM_000492.3
CFTR	Chr7:117229530	c.1680-877G>T	NM_000492.3	rs397508261
CFTR	Chr7:117243855	c.2908+19G>C	NM_000492.3	rs370683572
CFTR	Chr7:117246713	c.2909-15T>G	NM_000492.3	rs397508455
CFTR	Chr7:117246840	c.2988+33G>T	NM_000492.3
CFTR	Chr7:117251609	c.3140-26A>G	NM_000492.3	rs76151804
CFTR	Chr7:117251619	c.3140-16T>A	NM_000492.3	rs767232138
CFTR	Chr7:117251624	c.3140-11A>G	NM_000492.3
CFTR	Chr7:117266272	c.3469-1304C>G	NM_000492.3
CFTR	Chr7:117267864	c.3717+40A>G	NM_000492.3	rs397508595
CFTR	Chr7:117280015	c.3718-2477C>T	NM_000492.3	rs75039782
CFTR	Chr7:117282680	c.3873+33A>G	NM_000492.3	rs397508622
CFTR	Chr7:117288374	c.3874-4522A>G	NM_000492.3
CHD7	Chr8:61734568	c.2836-15C>G	NM_017780.3
CHD7	Chr8:61757794	c.5051-15T>A	NM_017780.3
CHD7	Chr8:61763034	c.5405-18C>A	NM_017780.3	rs199981784
CHD7	Chr8:61763035	c.5405-17G>A	NM_017780.3	rs794727423
CHD7	Chr8:61763039	c.5405-13G>A	NM_017780.3	rs1131690787
CLCN7	Chr16:1506057	c.916+57A>T	NM_001287.5
CLCN7	Chr16:1507356	c.739-18G>A	NM_001287.5	rs371893553
COG6	Chr13:40273614	c.1167-24A>G	NM_020751.2	rs730882236
CTSC	Chr11:88070895	c.-55C>A	NM_001814.4	rs766114323
CYBA	Chr16:88712620	c.288-15C>G	NM_000101.3
CYBB	ChrX:37639262	c.-69A>C	NM_000397.3
CYBB	ChrX:37639262		NM_000397.3
CYBB	ChrX:37639264	c.-67T>C	NM_000397.3
CYBB	ChrX:37639266	c.-65C>T	NM_000397.3
CYBB	ChrX:37639267	c.-64C>T	NM_000397.3
CYBB	ChrX:37641327	c.46-14_46-11delTTCTinsGAA	NM_000397.3
CYBB	ChrX:37641330	c.46-11T>G	NM_000397.3
CYBB	ChrX:37642713	c.142-28_142-12delACTCTGCTCCCTTTCCC	NM_000397.3
CYBB	ChrX:37642731	c.142-12delCinsACCTCTTCTAG	NM_000397.3
CYBB	ChrX:37654041	c.483+978G>T	NM_000397.3
CYBB	ChrX:37656474	c.674+1080A>G	NM_000397.3
CYBB	ChrX:37656731	c.674+1337T>G	NM_000397.3
CYBB	ChrX:37657051	c.675-1157A>G	NM_000397.3
CYBB	ChrX:37664248	c.1152-11T>G	NM_000397.3
DGKE	Chr17:54925466	c.888+40A>G	NM_003647.2
DKC1	ChrX:153991099	c.-142C>G	NM_001363.3	rs199422241
DKC1	ChrX:153991100	c.-141C>G	NM_001363.3
DKC1	ChrX:153993704	c.85-15T>C	NM_001363.3
DNMT3B	Chr20:31395557	c.2421-11G>A	NM_006892.3	rs547940069
DOCK8	Chr9:317025	c.742-18C>G	NM_203447.3	rs112373444
DOCK8	Chr9:317028	c.742-15T>G	NM_203447.3	rs111627162
DOCK8	Chr9:368196	c.1797+61A>C	NM_203447.3	rs786205596
FANCA	Chr16:89805127	c.4261-19_4261-12delACCTGCTC	NM_000135.3
FANCA	Chr16:89816056	c.3239+82T>G	NM_000135.2
FANCA	Chr16:89818822	c.2982-192A>G	NM_000135.2
FANCA	Chr16:89831215	c.2778+83C>G	NM_000135.2	rs750997715
FANCA	Chr16:89836111	c.2504+134A>G	NM_000135.2
FANCA	Chr16:89836805	c.2223-138A>G	NM_000135.2
FANCA	Chr16:89849346	c.1567-20A>G	NM_000135.2	rs775154397
FAS	Chr10:90770494	c.506-16A>G	NM_000043.4
FASLG	Chr1:172628081	c.-261T>C	NM_000639.1
FOXP3	ChrX:49121118	c.-23+5G>A	NM_014009.3
FOXP3	ChrX:49121121	c.-23+2T>G	NM_014009.3
FOXP3	ChrX:49121122	c.-23+1G>A	NM_014009.3
FOXP3	ChrX:49121122	c.-23+1G>T	NM_014009.3
G6PC	Chr17:41059684	c.446+39G>A	NM_000151.3
G6PC	Chr17:41059687	c.446+42G>A	NM_000151.3
GATA2	Chr3:128202131	c.1017+572C>T	NM_032638.4
GATA2	Chr3:128202162	c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC	NM_032638.4
GATA2	Chr3:128202171	c.1017+532T>A	NM_032638.4
GINS1	Chr20:25388397	c.-60A>G	NM_021067.3
GINS1	Chr20:25388409	c.-48C>G	NM_021067.3
IL10RB	Chr21:34668714	c.*52C>T	NM_000628.4
IL2RG	ChrX:70327277	c.307_308delAA	NM_000206.2
IL2RG	ChrX:70327278	c.*308A>G	NM_000206.2
IL2RG	ChrX:70330553	c.270-15A>G	NM_000206.2
IL7R	Chr5:35867853	c.379+288G>A	NM_002185.3
ITGB2	Chr21:46320404	c.742-14C>A	NM_000211.3	rs183204825
ITGB2	Chr21:46321660	c.500-12T>G	NM_000211.3
JAK3	Chr19:17943239	c.2680+89G>A	NM_000215.3
JAK3	Chr19:17946035	c.1915-11G>A	NM_000215.3
LAMTOR2	Chr1:156028185	c.*23C>A	NM_014017.3
MEFV	Chr16:3306599	c.-12C>G	NM_000243.2	rs104895148
MEFV	Chr16:3306969	c.-382C>G	NM_000243.2
MVK	Chr12:110029032	c.769-7dupT	NM_000431.2	rs104895348
OFD1	ChrX:13768358	c.935+706A>G	NM_003611.2	rs730880283
OFD1	ChrX:13773245	c.1130-22_1130-19delAATT	NM_003611.2	rs312262865
OFD1	ChrX:13773249	c.1130-20_1130-16delTTGGT	NM_003611.2
PARN	Chr16:14724045	c.-165+2C>T	NM_001134477.2
PMS2	Chr7:6027263	c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC	NM_000535.5	rs751973268
PMS2	Chr7:6048599	c.23+21_23+28delTCCGGTGT	NM_000535.5
PNP	Chr14:20942914	c.286-18G>A	NM_000270.3
POLA1	ChrX:24744696	c.1375-354A>G	NM_016937.3	rs869312979
POLE	Chr12:133249181	c.1686+32C>G	NM_006231.2	rs762985435
POMP	Chr13:29233225	c.-95delC	NM_015932.5	rs112368783
PSENEN	Chr19:36236501	c.-192_-190delAGA	NM_172341.2	rs554724520
RAG2	Chr11:36619652	c.-28G>C	NM_000536.3
RFXANK	Chr19:19307761	c.188-11C>T	NM_003721.3	rs201545133
RMRP	Chr9:35658026		NR_003051.3	rs781730798
RMRP	Chr9:35658026		NR_003051.3
RMRP	Chr9:35658026		NR_003051.3
RMRP	Chr9:35658026		NR_003051.3
RMRP	Chr9:35658027		NR_003051.3
RMRP	Chr9:35658027		NR_003051.3
RMRP	Chr9:35658027		NR_003051.3
RMRP	Chr9:35658027		NR_003051.3	rs727502775
RMRP	Chr9:35658027		NR_003051.3
RMRP	Chr9:35658028		NR_003051.3
RMRP	Chr9:35658028		NR_003051.3
RMRP	Chr9:35658029		NR_003051.3
RMRP	Chr9:35658029		NR_003051.3
RMRP	Chr9:35658032		NR_003051.3
RNASEH2B	Chr13:51501530	c.65-13G>A	NM_024570.3
RNASEH2B	Chr13:51519550	c.511-13G>A	NM_024570.3
RPGR	ChrX:38128234		NM_000328.2
RPGR	ChrX:38160137	c.1059+363G>A	NM_001034853.1
RPSA	Chr3:39448260	c.-34+5G>C	NM_002295.4
SERPING1	Chr11:57365055	c.-163C>T	NM_000062.2
SERPING1	Chr11:57365057	c.-161A>G	NM_000062.2
SERPING1	Chr11:57365118	c.-100C>G	NM_000062.2	rs578018379
SERPING1	Chr11:57365720	c.-22-2A>C/G	NM_000062.2
SERPING1	Chr11:57365720	c.-22-2A>C	NM_000062.2
SERPING1	Chr11:57365720	c.-22-2A>G	NM_000062.2
SERPING1	Chr11:57365721	c.-22-1G>A	NM_000062.2
SERPING1	Chr11:57373471	c.686-12A>G	NM_000062.2
SERPING1	Chr11:57373867	c.890-14C>G	NM_000062.2
SERPING1	Chr11:57381788	c.1250-13G>A	NM_000062.2
SH2D1A	ChrX:123499593	c.138-17_138-11delAGTTTAT	NM_002351.4
SLC29A3	Chr10:73122778	c.*413G>A	NM_018344.5
SPINK5	Chr5:147465956	c.283-12T>A	NM_006846.3
SPINK5	Chr5:147484503	c.1431-12G>A	NM_006846.3	rs368134354
SPINK5	Chr5:147491511	c.1820+53G>A	NM_006846.3	rs754599628
STX11	Chr6:144508713	c.85_86insT	NM_003764.3
STXBP2	Chr19:7705761	c.326-23_326-16delGCCCCACT	NM_006949.3
TAZ	ChrX:153641699	n.694+4G>A	NR_024048.1
TAZ	ChrX:153649161	c.778-63_778-51delCTCCCAGGGCACC	NM_000116.3	rs782249471
TBX1	Chr22:19743578	c.-777C>T	NM_080647.1
TBX1	Chr22:19743735	c.-620A>C	NM_080647.1	rs536892777
TCN2	Chr22:31011112	c.581-176A>T	NM_000355.3
TCN2	Chr22:31011112	c.581-176A>G	NM_000355.3	rs372866837
TERC	Chr3:169482870	n.-22C>T	NR_001566.1
TERC	Chr3:169482906		NR_001566.1
TERC	Chr3:169482948	n.-100C>G	NR_001566.1	rs199422256
TERC	Chr3:169483086		NR_001566.1	rs199422255
TERT	Chr5:1271334	c.2383-15C>T	NM_198253.2	rs574645600
TERT	Chr5:1295161	c.-57A>C	NM_198253.2
THBD	Chr20:23030319		NM_000361.2
THBD	Chr20:23030443	c.-302C>A	NM_000361.2
TRNT1	Chr3:3188088	c.609-26T>C	NM_182916.2
TTC7A	Chr2:47249223	c.1510+105T>A	NM_020458.2
UNC13D	Chr17:73826245	c.2831-13G>A	NM_199242.2
UNC13D	Chr17:73827442	c.2448-13G>A	NM_199242.2	rs753762300
UNC13D	Chr17:73839907	c.118-307G>A	NM_199242.2
UNC13D	Chr17:73839908	c.118-308C>T	NM_199242.2
WAS	ChrX:48547690	c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC	NM_000377.2
ZAP70	Chr2:98349927	c.838-80G>A	NM_001079.3	rs113994173
ZAP70	Chr2:98354447	c.1624-11G>A	NM_001079.3	rs730880318

Legend

HGVS: Human Genome Variation Society nomenclature used to describe sequence variants (e.g., c.2678-15C>A).
RefSeq: Reference sequence accession (transcript) used for variant annotation (NCBI RefSeq, e.g., NM_000138.4).
RS-number: dbSNP reference ID (rsID) for the variant when available.
Genomic location (HG19): Chromosomal coordinates based on the human genome build GRCh37/hg19.

Genetic testing for this gene is performed by taking a blood sample or by taking genetic material from inside the cheeks (with a swab), and can be done:

By taking the sample at Diagnostiki Athinon. Book your appointment in real-time and purchase the test online
By taking the sample at home. We send you all the necessary collection materials to your home via courier. The courier also returns the sample to the laboratory. Purchase the test online

Test Strengths

The test is characterized by the following strengths:

Analysis is performed in a CAP-accredited laboratory with the participation of CLIA-certified personnel.
Advanced sequencing technologies, high-performance target enrichment methods, and precise bioinformatics pipelines ensure superior analytical performance.
Gene panels are carefully designed to be clinically effective and scientifically validated.
In some panels, the entire mitochondrial genome is included (see Panel Content section).
Approximately 2,000 non-coding disease-causing variants are covered in the clinical-grade NGS assay (see Non-coding disease-causing variants covered by this panel in the Panel Content section).
A rigorous variant classification system is applied.
A systematic interpretation workflow, supported by proprietary software, enables accurate and traceable processing of NGS data.
Comprehensive and clinically meaningful reports are provided.

Test Limitations

Specific technical and biological limitations apply:

The following exons are excluded from the panel due to insufficient coverage by high-quality sequencing reads: ARMC4 NM_001290021.2:13;NM_018076.5:9, C5 NM_001317164.2:21, CD55 NM_001300902.2:10;NM_001300903.2:10, CORO1A NM_007074.4:11, CSF2RA NM_001161530.2:11, HYDIN NM_001270974.2:6,8,12,18,20,21,23,26,27,31,35,37,45,47,50,52,57,58,64,70,75,78,82,83, IL12RB1 NM_153701.3:10, IL6R NM_001206866.2:7, NCF1 NM_000265.7:1,5,8,9,11, PGM3 NM_001199919.2:14, PMS2 NM_000535.7:13-15, TNFRSF1A NM_001346092.2:6, USP18 NM_017414.4:11, VPS45 NM_001279353.2:13.
Genes with suboptimal coverage are marked with a number sign (#), while those with partial or complete segmental duplications overlapping UCSC pseudogene regions are marked with an asterisk (*).
A gene is considered to have suboptimal coverage when more than 90% of its target nucleotides are not covered at a depth of greater than 20x with mapping quality score (MQ > 20) reads. In such cases, detection of variants may be limited.

This test does not detect:

Complex inversions
Gene conversions
Balanced translocations
Repeat expansion disorders, unless otherwise specified
Non-coding variants beyond ±20 base pairs from the exon–intron boundary, unless otherwise indicated
The complete mitochondrial genome in all panels (see Panel Content section

This test may not reliably detect:

Low-level mosaicism in nuclear genes (variants with a minor allele fraction of ~14.6% are detected with 90% probability)
Stretches of mononucleotide repeats
Low-level heteroplasmy in mtDNA (>90% detected at 5% level)
Insertions or deletions larger than 50 bp
Single-exon deletions or duplications
Variants within pseudogene regions or duplicated genomic segments
Disease-causing mtDNA variants not present in blood; in such cases, post-mitotic tissue (e.g., skeletal muscle) may be required to establish a molecular diagnosis

For further details, please refer to the Bioinformatics & Performance section.

Bioinformatics

The target region for each gene encompasses the coding exons as well as ±20 base pairs from the exon–intron boundaries. In addition, the panel may include non-coding and regulatory variants, as listed in the “Non-coding variants covered by the panel” section. Specific regions of certain gene(s) may be excluded from analysis if noted in the “Test limitations” section. When the test includes the mitochondrial genome, the target region also comprises the complete set of mitochondrial genes.

Sequencing data is processed through a proprietary analysis and annotation pipeline that integrates state-of-the-art algorithms and industry-standard software solutions. Multiple quality control steps are embedded throughout the workflow to ensure the accuracy, validity, and consistency of the results. The pipeline is optimized to maximize sensitivity without compromising specificity.

For variant interpretation, the system incorporates data from multiple reference populations and mutation databases, including (but not limited to) the 1000 Genomes Project, gnomAD, ClinVar, and HGMD. In silico tools such as SIFT, PolyPhen, and MutationTaster are also applied to support the classification of missense variants.

All findings are summarized in a clear and detailed clinical report. This report includes sequencing quality metrics, gene-level coverage information, and highlights any regions where coverage is limited (<20x for nuclear genes and <1000x for mtDNA, when applicable). This ensures transparency and supports accurate clinical decision-making.

Test Performace

The genes included in this panel have been carefully selected based on evidence from scientific literature, mutation databases, and accumulated clinical expertise.

All panels are derived from a high-quality, clinical-grade NGS assay. Details regarding the detection of different types of genetic alterations are provided in the sequencing and detection performance table (see Table).

The assay has been validated for several sample types, including EDTA blood, isolated DNA (excluding DNA from formalin-fixed paraffin-embedded tissue), saliva, and dried blood spots (filter cards). These sample types were chosen to maximize the probability of obtaining high-quality DNA. The diagnostic yield may vary depending on the assay performed, the referring healthcare professional, the hospital, and the country in which the test is conducted. The Plus Analysis further enhances the chance of reaching a genetic diagnosis, as large deletions and duplications cannot be detected by sequencing alone. This approach integrates both sequencing and deletion/duplication (copy number variant, CNV) analysis.

The performance metrics shown below are based on initial validation studies at an accredited clinical laboratory, with equivalent results confirmed across additional laboratory sites.

Performance of a high-quality, clinical-grade NGS sequencing assay for panels

Variant type	Sensitivity % (TP/(TP+FN))	Specificity %
Single-nucleotide variants (SNVs)	99.89% (99,153/99,266)	>99.9999%
Insertions, deletions, and indels by sequence analysis
1-10 bps	99.2% (7,745/7,806)	>99.9999%
11-50 bps	99.13% (2,524/2,546)	>99.9999%
Copy number variants (exon level dels/dups)
1 exon deletion (het)	100% (20/20)	NA
1 exon deletion (homo)	100% (5/5)	NA
1 exon deletion (het or homo)	100% (25/25)	NA
2-7 exon deletion (het or homo)	100% (44/44)	NA
1-9 exon duplication (het or homo)	75% (6/8)	NA
Simulated CNV detection
5 exons del/dup	98.7%	100.00%
Microdeletions/-duplications (n=37)
Size range (0.1–47 Mb)	100% (25/25)

Coverage metrics

Mean sequencing depth	143X
Nucleotides with >20x coverage (%)	99.86%

Performance of Mitochondrial Sequencing Assay

Variant type/condition	Sensitivity %	Specificity %
Analytic validation (n=4 samples)
SNVs Heteroplasmic (45-100%)	100% (50/50)	100%
SNVs Heteroplasmic (35-45%)	100% (87/87)	100%
SNVs Heteroplasmic (25-35%)	100% (73/73)	100%
SNVs Heteroplasmic (15-25%)	100% (77/77)	100%
SNVs Heteroplasmic (10-15%)	100% (74/74)	100%
SNVs Heteroplasmic (5-10%)	100% (3/3)	100%
SNVs Heteroplasmic (<5%)	50% (2/4)	100%
Clinical validation (n=76 samples)
SNVs Heteroplasmic (45-100%)	100% (1940/1940)	100%
SNVs Heteroplasmic (35-45%)	100% (4/4)	100%
SNVs Heteroplasmic (25-35%)	100% (3/3)	100%
SNVs Heteroplasmic (15-25%)	100% (3/3)	100%
SNVs Heteroplasmic (10-15%)	100% (9/9)	100%
SNVs Heteroplasmic (5-10%)	92.3% (12/13)	99.98%
SNVs Heteroplasmic (<5%)	88.9% (48/54)	99.93%
Indels 1-10bp (het 45-100%)	100% (32/32)	100%
Indels 1-10bp (het 5-45%)	100% (3/3)	100%
Indels 1-10bp (het <5%)	100% (5/5)	99.997%
Simulation data
Indels 1-24bp Homoplasmic (100%)	100% (17/17)	99.98%
Indels 1-24bp Heteroplasmic (50%)	100% (17/17)	99.99%
Indels 1-24bp Heteroplasmic (25%)	100% (17/17)	100%
Indels 1-24bp Heteroplasmic (20%)	100% (17/17)	100%
Indels 1-24bp Heteroplasmic (15%)	100% (17/17)	100%
Indels 1-24bp Heteroplasmic (10%)	94.1% (16/17)	100%
Indels 1-24bp Heteroplasmic (5%)	94.1% (16/17)	100%
CNVs (artificial mutations; n=1500)
Homoplasmic (100%) 500bp–5kb	100%	100%
Heteroplasmic (50%) 500bp–5kb	100%	100%
Heteroplasmic (30%) 500bp–5kb	100%	100%
Heteroplasmic (20%) 500bp–5kb	99.7%	100%
Heteroplasmic (10%) 500bp–5kb	99.0%	100%

Mitochondrial assay coverage metrics

Metric	Mean of medians	Median of medians
Mean sequencing depth MQ0 (clinical)	18224X	17366X
Nucleotides with >1000x MQ0 coverage (%)	100%
ρ0 cell line (=no mtDNA), mean sequencing depth	12X

Comprehensive clinical reports are delivered, designed to provide healthcare professionals with meaningful and actionable insights. Clinical interpretation requires a solid understanding of both clinical genetics and genetic principles. Reports are prepared by teams of molecular geneticists, medical experts, and other highly experienced professionals, who evaluate identified variants in the context of the patient’s phenotypic information provided in the requisition form.

The goal is to ensure that reports are clinically valuable and understandable to all healthcare providers, regardless of their level of training in genetics and genetics-related fields. Variant classification forms the foundation of clinical interpretation and guides patient management decisions. Classifications follow the ACMG 2015 guidelines. Sequence and copy number variants classified as pathogenic, likely pathogenic, or of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or orthogonal methods such as qPCR/ddPCR whenever NGS quality metrics do not meet strict thresholds for a true positive call.

Each report includes tables for sequence and copy number variants, presenting essential information such as genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypic correlations, and variant classification. In addition, detailed descriptions are provided for the variant, the gene, and the related phenotypes, covering the gene’s role in human disease, mutation spectrum, variation in population cohorts, and links to associated conditions. References, abstracts, and variant databases are also cited, enabling healthcare providers to further evaluate reported findings if desired.

Reports are structured into two sections: primary findings and additional findings.

The primary findings consist of variants known to cause disease or rare variants that may explain the patient’s phenotype. The conclusion summarizes all available evidence and presents the rationale for classification.

Additional findings include variants that are not currently sufficient to explain the patient’s phenotype, based on existing knowledge. Examples include heterozygous variants in autosomal recessive genes, VUS in autosomal dominant genes (when a pathogenic or likely pathogenic variant already explains the phenotype), or risk alleles in genes included in the panel.

The identification of pathogenic or likely pathogenic variants in dominant disorders, or biallelic variants in recessive disorders, is considered molecular confirmation of the clinical diagnosis. In such cases, family testing may assist in risk assessment. Variants of uncertain significance are not recommended for patient management or family risk stratification. Genetic counseling is strongly advised.

Interpretation teams routinely analyze millions of variants across thousands of cases of rare diseases. With each case, internal knowledge of variant–phenotype relationships is enriched, enabling continuous refinement of classifications. As new evidence becomes available, previously reported variants may be reclassified. If a variant initially reported as a primary or secondary finding is later reclassified (for example, from VUS to pathogenic/likely pathogenic, or from pathogenic/likely pathogenic to VUS, likely benign, or benign), an updated statement is issued to the original ordering healthcare provider at no additional cost.